🐫 Chord Rocket Rockers Bersama Taklukan Dunia
ChordLirik Drive - Yang Kedua. D A/C# Bm sudah kukatakan aku ini A tak sendiri D A/C# telah ku ungkapkan Bm G A rahasia diriku Reff : D kujadikan kau yang kedua A/C# tak berarti tak cinta Bm aku dan dia G A hanya sementara D A/C# jujur ku katakan Bm A saat ini ku masih dengannya
KunciGitar Dul Jaelani - Taklukan Dunia Chord Dasar Transpose: Auto Scroll Capo di fret 3 Intro : C .. C Ku tahu engkau menunggu Am Menantikan mimpimu F Bersabarlah kau cintaku C G Serahkan pada waktu.. C Berikanlah aku waktu Am Aku berjanji padamu Dm Akan ku raih mimpiku F G C Untukmu untukku cintaku.. Reff I: Dm F Ku masih menantikanmu..
F# E B G# D#m G#m C# G D# C C#m] Chords for Rocket Rockers HD LIVE - Reaksi Rasa - Bersama Taklukkan Dunia with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin.
GC D G terlintas keinginan tuk dapat G C D G hilang ingatan agar semua terlupakan G C D G dan ku berlari sekencang-kencangnya G C D Em tuk melupakanmu yang tlah berpaling C Em C D yang tlah berpaling Reff : G C Am disini kembali kau hadirkan C D Em ingatan yang seharusnya kulupakan D C dan kuhancurkan adanya
Bersama Taklukan Dunia" lagu ini bercerita tentang sebuah bersahabtan yang selamanya akan bersama menghadapi dunia C G Am G teringat kembali satu permainan F C Dm G yang sering dirimu dan aku mainkan C G Am G raihlah tanganku, genggam jabat erat
OfficialMusic Video BERSAMA TAKLUKAN DUNIA 2nd single taken from 5th album of Rocket Rockers MEREKAM JEJAK OUT NOW! 5th Album of Rocket Rockers MEREK
COMINGSOON on 18 August 2015 Official Music Video Bersama Taklukan Dunia (Breakout NET TV 15.00 WIB)Special thx to :Gania AliandaTile Preman PensiunAl Kauts
Chordrocket rockers bersama taklukan dunia | VioLirik - Hai pengunjung setia VioLirik, Pada update kali ini VioLirik akan berbagi lirik lagu terbaru yang berjudul Chord rocket rockers bersama taklukan dunia, sudah banyak lagu yang telah kami sediakan lirik dan kunci gitar hanya untuk kamu pengunjung setia VioLirik termasuk artikel Chord rocket rockers bersama taklukan dunia.
Chordrocket rockers bersama taklukan dunia C G Am G teringat kembali satu permainan F C Dm G yang sering dirimu dan aku mainkan C G Am G raihlah tanganku, genggam jabat erat F C Dm G menari bersama, tertawa ceria Am G dan ku kembali demi masa lalu Dm G kawan sejati takkan pernah pergi Reff : C G Am jangan ragu kawanku tuk singgahi tempat ini F G C
Af91. album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose EEEDmEAEEEEEGmEEEEECmEEEEEEDmEEGEEEEFEEEEEEEDEEEEEEEFEEEBEAmEGEEEBEEEGEEEBEEEGEEEBECEEEFEEEEEEEEEEEEEEEEEEEDmEEECEFEEEBEFEECEEEFEEEEEEEEEEEDEEECEFEEEEEEEEEEEDmEFEEBEEEFEEEEBEDmEEEEEBEGEEEEBEEGEEEEECEEEEFEEEEEEEEEEEEEEEEEEEDmEEECEFEEEEEEEGEEEBEFEECEEFEEEGEEEBEEECEEEFEEEGEEBEEECEEEEBEFECEFEBEFECFEEEEECEDmEBECEFEEEEEEECEEEBEFEEEEEEEEEEEEDmEEECEFEEEEECEBEEEEEEEEEEEEEN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNNNNNNNNNNNNNNNNNNNCNNNANNNNNFNNNNNNNNNNNBNNFNNNANNNNNCNNNNNNBNNNNNNGNNFNNNNNNNNNAmNNDNNNNNNBNNCNNNGNNNNNNNBNNNNGmNNNNNNNNNCNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNCNNNNNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNCNNFNNNNNNNNNNNNNNNNNNNNNNNNNNBNNNNNNNFNNNNBNNNNNNDmNNNNNNNFNNNNGmNNNNNNNNNNNNNGNNNNNNNNNCNNNNNNNNNFNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNDmNNNNNNFNNNNNNNNNNNNNNNGNNNDNNBNNDmNNNCNNNNNFNNNNNNGNNNNNNBNNGNNCNNNGNNFNNNNNNGNNNNNBNNNNNNCNNNNNNBNNFNNNNNNNNNNNNNNNNNNNNNNBNNNNNNCNNDmNNNBNNNNNFNNNNNNNNNNNNNNCNNNNBNNNFNNNNNNNNNNNNNNNNNNNDmNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCFmCCCCCACFCCCCCCCCCCCCFCCCCCFCCCCCFCCCFCAmCCCFCCCCCGCCCACCCGCCCCCCCCCFCCCCCCCCCCCCCCCCCCCDmCACCCFCCCACFCCCCCCCFCCCCCACFCCCDmCCCCCFCCCCCCCCCACCFCCACCCFCCCCACCCCCCCCCCGCCCACCCCGmCCACCCCCACFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGCACFCCCCCFCCCCGCCACCCCCCCFCCCCCCGCACCCCCCCFCCCCGCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCCCACCCCCFCCCCGCCACCCCCCCCFCCCCFCACFCCCFCACFCCCCDmCCCCFCCCCCCCCCCCCFCCCCCCCCCCCCFCCCCCFCCDmCCCACCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
chord rocket rockers bersama taklukan dunia